إضافة رد 
 
تقييم الموضوع :
  • 1 أصوات - بمعدل 1
  • 1
  • 2
  • 3
  • 4
  • 5
مقدمة عن التطور
الكاتب الموضوع
بنى آدم غير متصل
من أين جاء العالم وأين ينتهى ؟
*****

المشاركات : 2,205
الإنتساب : Mar 2007
مشاركات : #1
مقدمة عن التطور

إلى أولئك الذين يبحثون عن الحقيقة مجردة من الأهواء .. أوجه هذه الأسئلة لمعارضى حقائق التطور جمعت هذه الأسئلة من مداخلات لى سابقة ومن مداخلات زملاء كرام أيضا كى لا أكرر نفسى كل يوم مع أحدهم

يصنف العلم الإنسان كالآتى :

مملکة : الحيوانات
شعبة : الحبليات
صنف : الثدييات
رتبة : الرئيسيات (الإنسان والقردة)
عائلة : قردة عليا (أشباه الإنسان)
الجنس : إنسان Homo
النوع : إنسان عاقل Homo Sapiens
النوع الفرعي : إنسان عاقل عاقل Homo sapiens sapiens

Scientific classification e
Kingdom: Animalia
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Tribe: Hominini
Genus: Homo
Species: H. sapiens

http://en.wikipedia.org/wiki/Human
http://en.wikipedia.org/wiki/Homo_Sapiens

وهذه أدلة للتطور مفصلة من موسوعة الويكبيديا

http://en.wikipedia.org/wiki/Evidence_of_evolution

ولكن هذا كله يجعلنى اسأل عدة أسئلة لأولئك الذين ينقدون التطور ولما يقرؤا فيه سطرا واحدا

أولا :

النقطة الأولى التى تحتاج إلى إجابه من ناكرى التطور كحقيقة علمية هى الأعضاء الأثرية remnants

هذه القائمه تعطي اهم عشر تغيرات تطوريه طرأت علي الانسان المعاصر وتركت اثارها ورائها :

(1) قشعريره الجلد / Goose Bumps
البشر المعاصرون تحصل لهم هذه القشعريره في الجلد عندما يكونون بردانين أو خائفين أو غاضبين .. العديد من الكائنات الاخري تحصل لها القشعريره لنفس الأسباب .. الكلب والقطه مثلا.

عندما يرتفع الشعر في وقت القشعريره الي الأعلي في الكلب فإن الشعر المنتصب يأسر القليل من الهواء بينه وبين الجلد مما يساعد علي التدفئه , أو عند الخوف هذه الألية تجعل الكائن الحي يبدو أضخم لإرهاب أعدائه الطبيعيون.


البشر الحاليون لاينتفعون من هذه القشعريره وهيا فقط شيء خلفه لنا الماضي التطوري من أسلافنا , الإنتقاء الطبيعي أزال الشعر الكثيف ولكن بقت أثار التحكم به عند البرد أو الخوف موجوده الي الوقت المعاصر في أجساد البشر.

http://en.wikipedia.org/wiki/Goose_bumps

(2) جهاز جاكبسون / Jacobson’s Organ
هذا الجهاز هو جزء رائع من البنيه التشريحيه للكثير من الحيوانات ويخبرنا الكثير عن تاريخنا الجنسي خاصه , الجهاز موجود في الأنف وهو جهاز لشم مخصص الوظيفه يعمل مع الأنف ولكنه يلتقط الفيرمونات "الماده الكيمياويه التي تطلق الرغبه الجنسيه , أو التنبيه , والمعلومات حول أماكن الغذاء".

هذا الجهاز يمكن الحيوانات من تعقب النوع المشابه لها لممارسه الجنس , لمعرفه الأخطار المحتلمه , البشر يولدون مع جهاز جاكوبسن ولكن قدراته ومنذ وقت مبكر في حياه الإنسان تتضائل الي درجه أنه يصبح لافائده ولاطائل منه.

في العصور القديمه كان هذا الجهاز يستخدم من قبل البشر في تحديد شركاء جنسيين لما كان الإتصال والتواصل اللغوي غير ممكن ,, الأن الأمسيات الرومانسيه وغرف المحادثه والبارات أخذت مكان هذا الجهاز في عملية البحث عن شريك.

http://en.wikipedia.org/wiki/Jacobson%27s_Organ

( 3) خردة في حمضنا النووي / Junk DNA
في حين إن أغلب الصفات التي آلت الينا من الماضي التطوري لأسلافنا ظاهره يوجد البعض منها غير ظاهر ولكنه مخزن في شفرتنا الوراثيه.

مثلا البشر المعاصرون لديهم التركيب الخاص في شفرتهم الوراثيه الذي كان يستخدم في انتاج فيتامين سى يطلق عليها اسم : (L-gulonolactone oxidase)


معظم الحيوانات الأخري لديها هذا الجزء من الحمض الوراثي يعمل وتستطيع انتاج الفيتامين , بالنسبه للبشر وفي إحدي المراحل في التاريخ طفرة حورت الجين وسببت بتعطيل هذا الجزء الخاص مما جعل البشر غير قادرين علي انتاج فيتامين C ومعالجته.

وتحول الجزء المسؤول عن ذلك إلي خردة في الحمض النووي تشير الي أصلنا المشترك مع باقي الأنواع الأخري علي الأرض .. لذلك هذه النقطه علي وجه التحديده مثيره للإهتمام.

http://en.wikipedia.org/wiki/Junk_DNA

(4) عضلات الأذن الزائده / Extra Ear Muscles
عضلات الأذن خارجيه ، وعضلات الأذنيه تستخدم من قبل الحيوانات لتحريك والتلاعب في آذانهم (بغض النظر عن رأسه) طبعا من أجل التركيز على سماع أصوات على معينه وجه الخصوص قادمه من منطقه معينه.

البشر لا يزالون يملكون اثار لهذه العضلات بصوره ضعيفه والتي بالتأكيد إستخدمناها في الماضي لنفس السبب الذي تستخدمه الحيوانات حاليا لكن لدينا العضلات ضعيفة حتى الآن أن وكل ما تستطيعون القيام به هو إعطاء آذاننا ذبذبه بسيطه.

(5) العضلة الأخمصيه / plantaris muscle
عضلة تستخدم من قبل الحيوانات التي تمسك وتتلاعب بالأشياء بأقدامها .. شيء قد تراه مع القردة الذين يبدون قادرين علي استخدام أقدامهم وكذلك أيديهم.

البشر لديهم هذه العضلات كذلك ، لكنها الآن متخلفة ولاوظيفه لها لأنهم لايجتاجونها .. حتى أنه كثيرا ما يأخذها الأطباء عندما يكونون في حاجة لإعادة بناء النسيج في أجزاء أخرى من الجسم.

العضلة هذه غير مهمه للجسد بشكل كبير لدرجه إن تسعه من كل مئه من البشر المعاصرون (9%) يولدون الآن دون هذه العضله.

http://en.wikipedia.org/wiki/Plantaris_muscle

(6) ضروس العقل / Wisdom Teeth

أوائل البشر كانوا يأكلون الكثير من النباتات .. كانوا بحاجة لتناول الطعام بسرعة تمكنهم من تناول الكمية كافية اللازمه لهم في يوم واحد للحصول على كل من المواد الغذائية التي يحتاجونها, لهذا السبب كان لدينا مجموعة إضافية من الأضراس لجعل الفم الأكبر أكثر قدره علي تناول الاعشاب.

وعند تغيير العادات الغذائيه للبشر .. عن طريق الضغط التطوري الذي اوقف قدرتنا علي هضم السيليلوز مما جعل البشر يتوقفون عن تناول الاعشاب الخضراء.

وجباتنا الغذائية تغيرت واصبح فك البشر ينمو بشكل اصغر واكثر مناسبه للظروف الجديده ، ومجموعه الأضراس الثالثة (اسنان العقل) أصبح لا لزوم لها.

بعض السكان من البشر الأن اسنانهم كامله النمو ولكن توقف تماما تنامي ضروس العقل لديهم .
وهى فقط مخلفات لافائده منها

http://en.wikipedia.org/wiki/Wisdom_Teeth

(7) طبقه الاجفان الثالثة / Third Eyelid
اذا كنت شاهدت من قبل قطا يطرف بعينه ستكون تعرف الغشاء الذي يحيط بمجال عينها من الداخل .. الذي يسمى بالجفن ثالث.

هو الى حد بعيد أمر نادر في الثدييات ، ولكنه موجود بكثره في عام الطيور والزواحف والأسماك.

البشر لديهم من بقاياه (الغير عاملة) والجفن الثالث قد أصبح صغيرا جدا في البشر ، ولكن بعض الأنواع تملكه أكثر وضوحا من غيرها

هناك نوع واحد فقط من الأنواع المعروفة من الرئيسيات القريبه للبشر التي لا تزال لديها جفن الاعين الثالث الذي يعمل بشكل فعال ، هو كالابار angwantibo

http://en.wikipedia.org/wiki/Third_eyelid

(8) نقطه داروين / Darwin’s Point
نقطه داروين موجودة في غالبية الثدييات , والبشر ليس إستثناء لأن بعضهم يحملها , من الأرجح إنها كانت تستخدم في المساعدة على تركيز أصوات الحيوانات بتجميعها , لكنه لم يعد لديه وظيفة في البشر.

حاليا فقط 10.4 ? (مئه واربع اشخاص لكل الف شخص) من سكان البشر لا يزالون يملكون هذا الاثر من العلامة مرئية التي تدل علي ماضينا.

ولكن من الممكن أن عددا أكبر بكثير من الأشخاص يحملون الجينات التي تنتج هذه العلامه ولكنهم لايظهر عليهم ذلك (لأنه لايؤدي وجود الجين دائما إلى حديبة الأذن على ما يبدو)

http://en.wikipedia.org/wiki/File:Darwin-s-tubercle.jpg

(9) العصعص / Coccyx
العصعص هو من بقايا ما كان يوما من الأيام ذيلا في الإنسان , مع مرور الزمن فقدنا الحاجة إلى وجود الذيل وتضامر تدريجيا (تم استبدال التأرجح علي الأشجار بالتجمعات قرب مصادر المياه للقيل والقال).

لكننا لم نفقد الحاجة إلى العصعص ذيلنا الضامر : فهو الآن لايزال يعمل بمثابة هيكل دعم لبعض العضلات وأيضا يدعم الشخص عندما يجلس ويميل الى الوراء , العصعص يدعم أيضا حالة فتحة الشرج.

http://en.wikipedia.org/wiki/Coccyx

(10) الزائدة الدودية / Appendix
الزائدة الدوديه لا وظيفه مفيده لها في الانسان المعاصر ، وغالبا ما تتم إزالتها عندما تصبح مصابة.

في حين أن إستخدام النموذج الأصلي قديما لا يزال غير أكيد ، ويتفق معظم العلماء مع داروين في إشارة الى إنها ساعدت البشر على معالجة السليلوز وهضمه قديما والذي كان موجودا في الأوراق الخضراء الغنيه بها "ماكان يوما من الأيام غذاء الإنسان الرئيسي" ، وبتغيير نظامنا الغذائي الزائده الدودية أصبحت أقل فائدة وتراجعت وظيفتها بمرور الزمن.

ما يثير الإهتمام بشكل خاص هو أن العديد من أصحاب النظريات التطورية يعتقدون أن الانتقاء الطبيعي (يزيل جميع قدرات الزائدة الدوديه) ولكنه يختار أكبرها للبقاء "بالرغم إنها عديمه الفائده" السبب لأن الزائدات الدوديه الأكبر أقل عرضة للإلتهاب والأمراض.

ولذلك على عكس إصبع قدمنا الصغير الذي يحتمل أن يختفي لأنه عديم الفائده , الزائدة الدودية من المحتمل أن تبقي معنا لوقت طويل نسبيا لمجرد التسكع لا تفعل شيئا.

http://en.wikipedia.org/wiki/Appendix

(11) الأثداء فى الرجال وتحتوى على غدد لبنيه ضامرة وبالرابط بالأسفل ستجد أن تكوين الثدى فى الرجل والمرأة متشابهان لأن أصلهما واحد

http://en.wikipedia.org/wiki/Breast

(12) عضلات الأذن حيث ضمرت حتى صارت كالعدم بينما بقيت فى حيوانات كثيرة مازالت قادرة على تحريك آذانها تحريكا كاملا


وهذا رابط عن الأعضاء الأثرية فى الإنسان بطريقة أكثر توسعا :

http://en.wikipedia.org/wiki/Human_vestigiality

وهذا رابط عن الأعضاء الأثرية للكائنات الحية عموما :

http://en.wikipedia.org/wiki/Rudiment_%28biology%29

وبالنسبة للحيوانات :

1- بعض ذكور الحيوانات الجرابية لديها آثار باقية خاصة بالكيس الجرابى

2- من المعلوم ان الحيتان انحدرت عن حيوانات اليابسة ذات الاطراف الاربعة، وانه، وعلى الاخص عند الحيتان الضخمة، يمكن العثور على عظام من بقايا الاطراف الخلفية، في داخل الهيكل العظمي للحيتان. بفضل المستحاثات، نعلم ايضا ان الحيتان القديمة كانت تملك قدما خلفية . ولها آثار واضحة جدا لليوم

http://en.wikipedia.org/wiki/Whale_evolution

3- للحيوانات المجترة كالبقر والجاموس اسنان حادة تحت اللثة اختفت ولم تعد تظهر لأن الحيونات هذه توقفت عن أكل اللحوم منذ زمن طويل فاختفت الأنياب الحادة

http://en.wikipedia.org/wiki/Marsupial

وهنا مئات الأعضاء الأثرية لكثير من الحيوانات لمن أراد الاستزاده والتفصيل

http://scholar.google.com.eg/scholar?q=r...i=scholart

يُتبع

حقائق ظهرت بعد الإنتهاء من الخريطة الجينية للإنسان في 2001 والقرد في 2005
● الشمبانزى أقرب جينيا الى الإنسان أكثر من قربه إلى الغوريلا .. أو إلى أى قرد آخر .
● التطابق الجينى بين الإنسان والشمبانزى يصل إلى أكثر من 96% .
● الجينات الفعالة فى الإنسان تبلغ 30000 جينا جميعها موجودة عند الشمبانزى عدا 53 جينا فقط .
● الأعضاء الأثرية فى الإنسان : الزائدة الدودية -ضروس العقل-أثداء الذكور-عضلات الأذنين والجلد - الفقرات الذيلية -أضلاع الرقبة - شعر الجسم

من منهم آدم ؟ : Ardi- Ida -Lucy -------- الإجابة قد تكون هنا
(آخر تعديل لهذه المشاركة : 06-18-2011 12:23 AM بواسطة بنى آدم.)
06-18-2011 12:22 AM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
بنى آدم غير متصل
من أين جاء العالم وأين ينتهى ؟
*****

المشاركات : 2,205
الإنتساب : Mar 2007
مشاركات : #2
RE: مقدمة عن التطور

ثانيا :

التقارب الجينى الهائل بين الإنسان والشمبانزى على وجه الخصوص فلماذا
لماذا يتوفق الإنسان جينيا مع الشمبانزى أكثر من توافق الشمبانزى مع بعض القرود الأخرى وبنسبة تزيد على 97%


التطوريون يؤمنون بأن الشمبانزي والغوريلا والأنسان أنحدرا من سلف مشترك كان يعيش على الأرض قبل 10 مليون سنه.
بينما الأنواع الأقل تشابها مع الأنسان كالفأر مثلا تفرعت عن الخط التطوري بمده تسبق هذه بملايين السنين.
الخلقيون يرفضون القبول بذلك,لما يحمله من معاني لاهوتيه متضمنه تناقض ماجاء بكتبهم الدينيه.
لكن التشابه بين الأنواع ليس مظهريا فقط,فلو رجعت الى تركيب البروتينات اللتي يتم تشفيرها من خلال الماده الوراثيه DNA ,ستجد تشابه كبير جدا:
مثال: البروتين المسمى Cytochrome C الموجود بالأنسان هو نفسه موجود بباقي الأنواع الحيه,مع أختلاف أستبدال نيكليوتايد واحد فقط لكل طفره,لذا يمكن حساب عدد الطفرات اللازمه لتحويل هذا البروتين من باقي الأنواع الى ماهو موجود عليه عند الأنسان:
بروتين القرد يحتاج طفره واحده..
بروتين الكلب يحتاج هي 13طفره ..
بروتين الحصان يحتاج 17طفره.
برويتن الدجاج يحتاج 18 طفره ..
بروتين الأفعى يحتاج 20 طفره.
بروتين السمك يحتاج 31طفره ..
وهذا يجعلنا نفكر بانهم انحدروا من سلف مشترك..وبفعل طفرات مترامكمه تغيرت بروتيناتهم .

الأنسان والقرده يحتاجون فيتامين سي في غذائهم,ان لم يتناولوه سيعانون من نقصه وبالتالي يمرضون,لانه لايمكنهم صنع فيتامين سي باجسامهم,بينما الثديات والأنواع الأخرى يمكنها صنع فيتامين سي وبالتالي لاتحتاج الى هذه الجزيئه في غذائها.
السبب في كوننا لانستطيع صنع فيتامين سي هو عدم امتلاكنا للمورثة أو الجين (gene)) الخاصه بتصنيع بروتين (انزيم) يساهم في صنع فيتامين سي,هذا الانزيم اسمه L-(gulono-gamma-lactone oxidase (GLO,...بينما باقي الثديات تمتلك هذه المورثه وبالتالي هذا الانزيم.

والدهشه الأكبر هي أن هذا الجين المعطل المشترك لدينا ولدى القرده ( chimpanzee, macaque, orangutan) تراه معطلا بنفس الطفرات هنا وهناك-- وهذا لايدع مجالا للخلقيين في القول بأنه ربما تم التطفرهنا وهناك بشكل مستقل بعد خلق كل نوع مستقلا فرضا-- لأنه ببساطه التطفرات عشوائيه ولايمكن أن تكون نفسها بالصدفه في الأنواع الأربعه(human, chimpanzee, macaque , orangutan),فالواقع المدهش أنه في كل هذه الأنواع تم تعطيل الجين بنفس الطريقه من خلال طفرة حذف نيوكليوتايد مشترك واحد.,
بالتأكيدا التطور يجيبك عن هذا ,بأن طفرة الحذف أعلاه حصلت عند سلفنا المشترك لكل من(human, chimpanzee, macaque , orangutan)قبل ملايين السنين فعطلت هذا الجين بطريقه واحده,ومن ثم مر هذا الجين نزولا لنا ولهذه الأنواع الثلاثه بالوراثه عن السلف المشترك لنا جميعا.

يوجد فى الإنسان 23 زوجا من الكروموسومات وفى القرد 24 زوجا ولكن الغريب أن هناك كروموسومين فى الإنسان قد التحما وهما p2 و k2 وقد كونا كروموسوما واحدا ويوجد به حتى الآن أثار التحام للكروموسومين القديمين وقد كونا الكروموسوم 2 عند الإنسان وآثار الإلتحام واضحه
عند فرد كروموسومي 2 في الشمبانزي ووضعما رأسيا فوق بعضهما فأنهما يعطيان التخطيط الحزمي لكروموسوم 2 عند الانسان دون أي أختلاف يذكر .

• في نهاية كل جزيئة DNA هناك سلسلة متعاقبة من القواعد النيتروجينية تسمى تيلومير ، ويختلف ترتيب القواعد فيها و طولها بأختلاف الكائن الحي ، ولها وظيفة مهمة أثناء انقسام هذه الجزيئة كما انها تحمي طرفها من تأثير الانزيمات . لو نظرنا الى الكروموسوم 2 عند الانسان فأننا سنرى تيلوميرات الشمبانزي في وسط الكروموسوم 2 تماما في المكان الذي التصق فيه طرفا كروموسومي القرد .

• توجد على كل كروموسوم منطقة معينة تسمى سنترومير لها وظيفة مهمة أثناء الانقسام الخلوي ، موقع السنترومير واحد في كروموسوم 2 عند الانسان وكروموسومي 2 في الشمبانزي .

تسلسلات الدى ان ايه DNA Deoxyribose Nucleic Acid

دى ان ايه لجين معين للإنسان TCAGTGCCTGCCGGAAATCTCCC
دى ان ايه من نفس الجين للقرد TCAGTATCTGCCGGAAATCTCCC
دى ان ايه من نفس الجين للفأر TTGGTGCCTTTTGCATGTTTGCC

جين آخر لإنسان ATGCTTCCGGGCACATT...ACGAG
نفس الجين للشمبانزى ATGCTTCCGGGCACATT...ACGAG
نفس الجين للفأر ATA..TCGGAGTACATCGCAACGAA

جين ثالث للإنسان ACCTGGTGGCA...ACCTACCCTTG
نفس الجين عند القرد ACCTGGTGGCA...ACCTACCCTTG
نفسه عند الفأر ACCCATTTTCATGAACTTACCGCTT

وهكذا مئات الآلاف من الجينات والتى ثبت منها أن الإنسان يتشابه مع الشمبانزى بنسبه تصل الى 97% بينما تشابه الشمبانزى مع غيره من القرود يقل عن هذه النسبه
لأن سلفنا مع الفأر مضى عليه من 80الى 100 مليون سنة أما سلفنا المشترك مع الشمبانزى فمر عليه عدة ملايين من السنين فقط عد 47 مليون عام

http://www.ramsdale.org/dna7.htm
http://en.wikipedia.org/wiki/DNA

يُتبع

حقائق ظهرت بعد الإنتهاء من الخريطة الجينية للإنسان في 2001 والقرد في 2005
● الشمبانزى أقرب جينيا الى الإنسان أكثر من قربه إلى الغوريلا .. أو إلى أى قرد آخر .
● التطابق الجينى بين الإنسان والشمبانزى يصل إلى أكثر من 96% .
● الجينات الفعالة فى الإنسان تبلغ 30000 جينا جميعها موجودة عند الشمبانزى عدا 53 جينا فقط .
● الأعضاء الأثرية فى الإنسان : الزائدة الدودية -ضروس العقل-أثداء الذكور-عضلات الأذنين والجلد - الفقرات الذيلية -أضلاع الرقبة - شعر الجسم

من منهم آدم ؟ : Ardi- Ida -Lucy -------- الإجابة قد تكون هنا
(آخر تعديل لهذه المشاركة : 06-18-2011 01:23 AM بواسطة بنى آدم.)
06-18-2011 01:20 AM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
البحث عن الحقيقة غير متصل
DIDO
***

المشاركات : 181
الإنتساب : Apr 2011
مشاركات : #3
RE: مقدمة عن التطور
(06-18-2011 12:22 AM)بنى آدم كتب :  [b][color=#000080]


يصنف العلم الإنسان كالآتى :

مملکة : الحيوانات
شعبة : الحبليات
صنف : الثدييات
رتبة : الرئيسيات (الإنسان والقردة)
عائلة : قردة عليا (أشباه الإنسان)
الجنس : إنسان Homo
النوع : إنسان عاقل Homo Sapiens
النوع الفرعي : إنسان عاقل عاقل Homo sapiens sanants

[size=large]
ما تقوله يناقض ما درسته .. الانسان لا ينتمي لمملكة الحيوان بل هو منفصل بذاته
هل هذا التصنيف في العلم ... أم في نظرية التطور فقط ؟

حائرة دائما و لا ادري أين الحقيقة أهي داخلي أم حولي ؟
06-18-2011 06:25 PM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
طريف سردست غير متصل
Anunnaki
*****

المشاركات : 2,507
الإنتساب : Apr 2005
مشاركات : #4
RE: مقدمة عن التطور
(06-18-2011 06:25 PM)البحث عن الحقيقة كتب :  
(06-18-2011 12:22 AM)بنى آدم كتب :  [b][color=#000080]


يصنف العلم الإنسان كالآتى :

مملکة : الحيوانات
شعبة : الحبليات
صنف : الثدييات
رتبة : الرئيسيات (الإنسان والقردة)
عائلة : قردة عليا (أشباه الإنسان)
الجنس : إنسان Homo
النوع : إنسان عاقل Homo Sapiens
النوع الفرعي : إنسان عاقل عاقل Homo sapiens sanants

[size=large]
ما تقوله يناقض ما درسته .. الانسان لا ينتمي لمملكة الحيوان بل هو منفصل بذاته
هل هذا التصنيف في العلم ... أم في نظرية التطور فقط ؟

اين درستي؟ وماهي المملكة التي ينتمي اليها الانسان حسب مادرستي؟
سيكون من الممتع الاطلاع على ذلك
06-18-2011 06:45 PM
زيارة موقع العضو عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
البحث عن الحقيقة غير متصل
DIDO
***

المشاركات : 181
الإنتساب : Apr 2011
مشاركات : #5
الرد على: مقدمة عن التطور
الانسان لا ينتمي لمملكة بل هو منفصل بذاته كما ذكرت
أنا درست المملكة الحيوانية و النباتية و مملكة الفطريات - و الفيروسات فقط لا غير
ولم أدرس ان الانسان ينحدر تحت أي منهما ....... ربما لان الدول الاسلامية تخلط بين الدين و العلم فلم توضح هذه النقطة
و معلوماتي لا تتعدى ما درسة و احاول أن اكسب المزيد من العلم منكم

أنا لا أكذب الزميل بني ادم طبعا فأنا أثق بما يقول .. و لكني اتساءل !!!

حائرة دائما و لا ادري أين الحقيقة أهي داخلي أم حولي ؟
06-18-2011 07:00 PM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
طريف سردست غير متصل
Anunnaki
*****

المشاركات : 2,507
الإنتساب : Apr 2005
مشاركات : #6
RE: الرد على: مقدمة عن التطور
(06-18-2011 07:00 PM)البحث عن الحقيقة كتب :  الانسان لا ينتمي لمملكة بل هو منفصل بذاته كما ذكرت
أنا درست المملكة الحيوانية و النباتية و مملكة الفطريات - و الفيروسات فقط لا غير
ولم أدرس ان الانسان ينحدر تحت أي منهما ....... ربما لان الدول الاسلامية تخلط بين الدين و العلم فلم توضح هذه النقطة
و معلوماتي لا تتعدى ما درسة و احاول أن اكسب المزيد من العلم منكم

أنا لا أكذب الزميل بني ادم طبعا فأنا أثق بما يقول .. و لكني اتساءل !!!

عزيزتي
لا اوجه اية اتهامات، نحن هنا كلنا لنتعلم المزيد فقط..
من المثير ان اعرف اية دولة عربية تعلم طلابها ان الانسان ينتمي الى مملكة خاصة به؟
ثم سيكون من المفيد معرفة اذا كنت تتعلمين تعليم اكاديمي ام ثانوي مثلا. وبشكل عام لو تتفضلين وتضعين كلمة Homo Sapiens في محرك البحث ستصلين الى التصنيفات البيلوجية للانسان. على الاقل الويكبيديا
http://en.wikipedia.org/wiki/Human

ولن تجدي ابدا ان الانسان ينتمي الى مملكة قائمة بذاتها. لذلك سأكون فعلا شاكرا اذا تمكنت من الاطلاع على تصنيفات بديلة. هل تتكون مملكة الانسان من الانسان وحده فقط؟ لم ارى حتى الان مملكة تتكون من نوع واحد لاغير. اليس الامر مثيرا؟
(آخر تعديل لهذه المشاركة : 06-18-2011 07:16 PM بواسطة طريف سردست.)
06-18-2011 07:15 PM
زيارة موقع العضو عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
البحث عن الحقيقة غير متصل
DIDO
***

المشاركات : 181
الإنتساب : Apr 2011
مشاركات : #7
الرد على: مقدمة عن التطور
نعم مثير و لم انتبه اليه الا الان
شغفي بعلم الاحياء و حبي الشديد لها هو ما جعلني ادرس هذه المادة باختياري .. درستها في السعودية و ليس في مصر ولا اعرف
هل المناهج تختلف هنا عن هناك أم ماذا ؟

المهم هو
طالما أن الانسان يندرج تحت مملكة الحيوانات فلما الاعتراض على نظرية التطور اذن . ان كان العلم أقر بذلك فلا مجال للشك هنا .
أليس كذلك ؟

حائرة دائما و لا ادري أين الحقيقة أهي داخلي أم حولي ؟
06-18-2011 07:29 PM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
طريف سردست غير متصل
Anunnaki
*****

المشاركات : 2,507
الإنتساب : Apr 2005
مشاركات : #8
RE: الرد على: مقدمة عن التطور
(06-18-2011 07:29 PM)البحث عن الحقيقة كتب :  نعم مثير و لم انتبه اليه الا الان
شغفي بعلم الاحياء و حبي الشديد لها هو ما جعلني ادرس هذه المادة باختياري .. درستها في السعودية و ليس في مصر ولا اعرف
هل المناهج تختلف هنا عن هناك أم ماذا ؟

المهم هو
طالما أن الانسان يندرج تحت مملكة الحيوانات فلما الاعتراض على نظرية التطور اذن . ان كان العلم أقر بذلك فلا مجال للشك هنا .
أليس كذلك ؟

عزيزتي
الاعتراض على نظرية التطور هو ديني وليس علمي، ولذلك بالذات لن تجدي الا دول مثل السعودية تضع الانسان في مملكة خاصة به. مثل هذا التصنيف لم اسمع به قبلا ابدا. لن يكون غريبا ان تكون ايران والسودان يعتمدان التصنيف ذاته، ولكن لن تجديه في اي مؤسسة علمية حرة ابدا.

نعم المناهج تختلف في كل العالم عن مناهج الدول الدينية.. وليس للدولة الدينية والمؤسسة الدينية اية قدرة على الاعتراف بنظرية التطور مهما كانت البراهين، لان النظرية مباشرة وصريحة في التعرض للقصة الدينية عن الخلق من شخصين ونفيها، بما لايترك مجال للتأويل والالتفاف بدون سقوط، على الاقل الحركة السلفية والاصولية السنية والشيعية على السواء.
هذه هي المعضلة التي يقف امامها التعليم الديني الذي لايمكن له ان يكون محايد وعلمي
06-18-2011 09:27 PM
زيارة موقع العضو عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
بنى آدم غير متصل
من أين جاء العالم وأين ينتهى ؟
*****

المشاركات : 2,205
الإنتساب : Mar 2007
مشاركات : #9
RE: مقدمة عن التطور
طريف وديدو
شرفتما الموضوع .. وأنا ساكمله الليلة لكى يصبح مقدمة للتطور حتى لا يرهقك المبتدؤن يا طريف ويرفعوا ضغطك ساعتها يمكنك ان تحيلهم لهذا الموضوع ثم يناقشونك بعدها


ثالثا :

لماذا اختلفت سعة الجمجمة وحجم المخ عند الإنسان القديم والإنسان الحديث :
أسلاف الإنسان:

- الإنسان العاقل homo sapiens
وهو الإنسان الذى سبقنا مباشرة وتبلغ سعة جمجمته نحو 1500سم مكعب مثلنا تقريبا وهو الذى صنع الرسوم التى تحلى مغارة لاسكو مثلا
وكان يمسك الاشياء بأصابعه لا بكل كفه

- إنسان نياندرتال neandertal وسعة جمجمته نحو1450سم مكعب وكان يوارى موتاه التراب ويتحدث بالكلام المفهوم

- إنسان البيثكانثروبوس pithecanthropus اكتشف فى جزيرة جاوة ومنه انسان الصين sinanthropeالذى اكتشف بالقرب من بكين وسعة جمجمته تبلغ 1000 سم مكعب وكان يستخدم النار
ويمسك الأشياء بكل كفه لأنها ربما كانت ملتحمه

- الإنسان الأسترالى Asstralo-pitheque أهم نموذج له اكتشف عام 1959 فى جنوب بحيرة فكتوريا تنزانيا وسعة جمجمته500 الى 600 سم مكعب استخدم ادوات بدائية ومضى عليه أكثر من 600 ألف سنة

- الأوريوبيثيك oreopitheque اكتشفة عمال المناجم فى شمال روما قدر عمره بين 12-15 مليون سنة كان يمشى مستقيما وله فك به اسنان بشرية سعة جمجمته أكبر بقليل من أقرب قرد لنا

http://en.wikipedia.org/wiki/Anthropoid_Apes


------------------------------------------------------------

رابعا :

يحلو لبعض الإسلامويين أن يغالطوا العلم والعقل والمنطق بأن يجلسوا على مؤخراتهم لا ينبشون حبة رمل عن حبة أخرى ويكتفون بتوجيه الطعن والصراخ تجاه العلماء ولم نسمع عن عالم واحد ولو واحدا فقط استكشف شيئا عن التطور وكان ضد التطور كل ما نسمع عنهم علماء تدروشوا أو تحالفوا مع قوى أصولية لتغدق عليهم الأموال فانقلبوا ضد المنطق والعلم ولكن الجسد العلمى ينبذهم كالجربانين

من هذه الأغلوطات أن يقولوا بأن العصر الكامبرى ( منذ 530 مليون سنة تقريبا ) كان عصر خلق الإله لجميع الحيوانات لسبب بسيط هو أن العلماء ( التطويريون دائما ) قالوا بأنه لا وجود لأحافير قبل العصر الكامبرى وطبعا بتطور العلوم والإكتشافات ثبت أن هناك حفريات ولكنها رقيقة للغاية حيث كانت أجسام الحيوانات خالية تقريبا من العظام ولم تكن حيونات معقده كما نراها بل كانت أشبه بقنديل البحر وكانت أسلام الكائنات الحالية

وهكذا لم يعد هناك من مجال للطعن بخصوص الإنفجار الكمبرى

http://en.wikipedia.org/wiki/Cambrian_explosion

ثم طعنوا فى العين وقالوا أنه من المستحيل ان تتطور ولكن بعشرات الفيديوهات والإثباتات لعلماء بيولوجيين أكدوا وجود بقايا التطور فى العين البشريه والحيوانيه وبعض الأعين ظلت فى مرحلة معينه لأنها لم تحتاج لأن تتطور أكثر مثل عيون الديدان وبعضها تطورت اكثر من الإنسان مثل عيون النحل

http://en.wikipedia.org/wiki/Evolution_of_the_eye

كما يروق أحيانا لهؤلاء أن يعيشوا فى حلم خيالى يتخيلون فيه أن التطور كان موضه قديمة وأن العلماء فى الغرب قد أبطلوه وتخلوا عنه .. فى تمثيليه خياليه فى أذهانهم ويعينهم عليها الجهل المطبق الذى يلف بلادنا فى المنطقة العربية متجاهلين بكل كبر وغباء أن 99% من علماء البيولوجى فى العالم كله يؤمنون بالتطور كحقيقة .. وأن جميع الجامعات الغربية وبعض العربية تعتمد علي نظرية التطور كحقيقه ومنطلق لتفسير الكون والحياة

ولمن يريد المعرفة عن ( علم ) الحفريات وطريقة الكشف عنها وفهرستها وقياس عمرها والتحقق من كل شىء عنها فليراجع هنا ..

http://en.wikipedia.org/wiki/Palaentology

جاء بعد داروين من أثبت نظريته باكتشافه أن القارات كانت ملتصقة وهذه النقطة كانت تؤرق داروين حين احتار عندما وجد ان القارات منفصلة ورغم هذا فيها حيونات متقاربه جدا .. مات ولما يستطع أن يفسر هذا اللغز

مات ولما يدرك بعد كيف يقدر عمر الحفرية بالضبط حتى ظهرت الساعات البيولوجية والتى تصل الى 12 ساعة على رأسها الساعة الكربونيه والتى تمكننا من دراسة الحفرية ووقت ردمها بكل دقة

مات ولم يكن يعرف الجينات ولا الحامض النووى ولا كل هذه الأشياء ولكن عندما راهن الجميع على سقوط النظرية أمام هذه المستجدات إذ بها ترسخ أكثر واكثر وكل ما جاء من نتائج مخبرية حديثة اثبتت كلام داروين

حاول بعض الحمقى من الذين يبحثون عن المجد الشخصى الكاذب أن يزوروا جمجمة ويدعوا أنها حقيقية وما هى إلا برهة حتى قام علماء التطور بالكشف عن زيفها لسببين الأول أنهم يبحثون عن الحقيقة فقط والثانى لأنها تخالف النظرية فى تفاصيل كثيرة فكانت غير منطقية على الإطلاق وهو ما يعرف بإنسان بيلتدون ولليوم كلما تحدث تليميذ عن التطور يذكر هاته الواقعه

http://en.wikipedia.org/wiki/Charles_Dawson

نسبة 99.9% من العلماء البيولوجيين يؤمنون بالتطور

http://en.wikipedia.org/wiki/Level_of_su..._evolution



خامسا :

- لماذا يولد البشر مشوهون فإن كان ذلك لحكمة كما تقولون فلماذا يولد الحيوان مشوها هو الآخر .. لماذا بعض الأسماك ليس لها جنس ؟ لماذا الـ shemale والمزدوجى الجنس ؟
هل المسألة خطأ فى نسخ الجينات كما تقول نظرية التطور أم أن لديك شيئ ما جديد

ملايين الاطفال يولدون بعاهات جينية ناتجة عن اخطاء في نسخ الكروموسومات فما هو تفسير هذا عند مؤيدى أسطورة الخلق

------------------------------------------------------------

سادسا :

كيف كانت آليات وطريقة توزيع الحيوانات على الأرض عقب مرحلة الخلق .. هل تم توزيعها بالتساوى بين الكتله الأرضيه حيث لم يكن هناك قارات

وما هو تفسيركم لوجود الجرابيات فقط فى المناطق المعزولة عن القارات الرئيسية حيث توجد فى استراليا .. فهل هى مخلوقة فقط فى استراليا
ونشأة حيوانات معينة فى أماكن معينة معزولة بعد انفصال القارات لم تنتقل لقارات أخرى كالنمر ذو الناب وغيره

وإليكم اثباتات جغرافية لظاهرة التطور أنقلها بتلخيص عن كتاب داوكنز ( الانتخاب الطبيعى ) أو ( صانع الساعات الأعمى )

انفصلت القارات من حوالى 100 مليون سنة

http://en.wikipedia.org/wiki/Continental_drift

ومن يومها اتخذ التطور منحا لكل قارة مختلفا عن بقيه القارات ونشأت وظائف حيوانية متشابهة وتصل الى مايشبه التطابق احيانا فكل قارة بها آكلات العشب وبها آكلات آكلات العشب ( اللواحم ) فمثلا وحدث هذا فى عصر الديناصورات لذا نجد حفريات لها فى كل قارة على حدة ففى جنوب أميركا هناك كسلان الأرض العملاق ground sloth وفى أمريكا الجنوبية هناك ايضا خنزير غينيا العملاق الذى اندثر وحيوان فى حجم الخرتيت الحديث ولكنه من الجرذان والنمط العام بين القارات فى الثديات متشابه بسبب تشابه الوظائف سواء التنقيب أم الصائد الكبير أم الرعى فى السهول وفى استراليا هناك خلد الماء platypus وله منقار يشبه منقار البط وآكل النمل ذو الأشواك

هناك فى العالم مجموعتان من الثديات : الجرابيات وهى التى تلد اطفالها صغيرة جدا وتحتفظ بهم فى جراب والنوع الثانى ذوات المشيمة وهى الباقى ففى استراليا سيطرت ذوات الجراب وفى باقى العالم سيطرت ذوات المشيمة والنوعان موجودان فى امريكا الجنوبية

آكلات العشب وأشهرها الحمار الوحشى بإفريقيا والحمير بالصحارى والماشية مثل الbison فى امريكا الشمالية

كانت امريكا الجنوبية معزولة فى الفترة التى كان الخيل والماشية تتطور فيها فى اجزاء العالم الاخرى لذا فقد طورت مجموعتها الخاصة من العاشبات وتثبت الحفريات وجود عاشبات ضخمة وبعضها له خرطوم وبعضها يشبه الجمل وبعضها كان لا يشبه اى حيوان على وجه الأرض اليوم فقد كان فيها الليتوبترنات وهى تشبه الخيل كثيرا ولكن لا قرابة بينها على الاطلاق

وفى استراليا تطورت العاشبات وأنتجت الكنجر فبدلا من ان ينمى طريقة للجرى بأرجله الأربعة فقد نماها بأرجله الخلفية وذيل قوى طويل للتوازن

بالنسبة للاحمات فهناك النمر ذو السن السيف بالعالم القديم وهناك الثيلاسين أو الذئب ذى الجراب ( ويسمى أحيانا ذئب تسمانيا ) ويقال انه قد انقرض فعلا ولم يبق منه سوى أعداد بسيطة جدا وفى امريكا ظهر البوما ( كالأسد ) والجاجوار ( كالنمر )

فى امريكا الجنوبية ايضا لم يكن هناك ثمة كلاب ولا قطط حقيقية أثناء فترة العزلة الطويلة شأنها شأن استراليا ولكن كان هناك مرادفات جرابية كما باستراليا ايضا مث حيوان ثيلا كوزميلوس ويشبه نمر العالم القديم ذو السن السيف الذى اندثر حديثا وكان من الجرابيات

وفى استراليا ايضا خلد جرابى وفأر ايضا ذو جراب وآكل النمل ايضا جرابى وهو ميرميكوبيوس myrmecobius وكلها تشبه ما بالعالم القديم فى أشياء وتخالفه فى اشياء اخرى



يُتبع

حقائق ظهرت بعد الإنتهاء من الخريطة الجينية للإنسان في 2001 والقرد في 2005
● الشمبانزى أقرب جينيا الى الإنسان أكثر من قربه إلى الغوريلا .. أو إلى أى قرد آخر .
● التطابق الجينى بين الإنسان والشمبانزى يصل إلى أكثر من 96% .
● الجينات الفعالة فى الإنسان تبلغ 30000 جينا جميعها موجودة عند الشمبانزى عدا 53 جينا فقط .
● الأعضاء الأثرية فى الإنسان : الزائدة الدودية -ضروس العقل-أثداء الذكور-عضلات الأذنين والجلد - الفقرات الذيلية -أضلاع الرقبة - شعر الجسم

من منهم آدم ؟ : Ardi- Ida -Lucy -------- الإجابة قد تكون هنا
(آخر تعديل لهذه المشاركة : 06-18-2011 10:15 PM بواسطة بنى آدم.)
06-18-2011 10:10 PM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
بنى آدم غير متصل
من أين جاء العالم وأين ينتهى ؟
*****

المشاركات : 2,205
الإنتساب : Mar 2007
مشاركات : #10
RE: مقدمة عن التطور

وقبل أن أكمل لاحظت شيئا غريبا أثنا بحثى عن التطور باللغة العربية حين فوجئت بأكثر من 90% من النتائج هى ضد التطور ولنفيه ومن المضحك أنها لمنتديات غير علمية على الإطلاق فتجد منتدى التوحيد ومنتدى حراس العقيدة ومنتدى سفر الحوالى وغيره من المخرفين بينما عند البحث باللغة الإنجليزيه فإن جميع النتائج بلا استثناء تكون فعليا شرحا للنظرية بطرق مختلفه أغلبها علمى وأغلب النتائج إن لم يكن جميعها لمنتديات علميه أو تهتم بالعلم أو قواميس تتعرض للشرح اللغوى كما أن 100% من النتائج تؤيد وتؤكد التطور أو تعرض كلام الخلقيون مع رد العلماء عليه فسبحان من شق لسان الإنسان باللغات فالتخلف هنا والمنطق هناك

سابعا :

نظرية التطور تفسر لنا الأمراض والتفكير والأحلام والمشاعر والنوم كلها بطريقة مدروسة فما هو البديل عند ( أسطورة ) الخلق لكل هذا

التطور واصول الامراض
http://www.alzakera.eu/music/vetenskap/B...0001-1.htm

كيف تطور العقل البشري لزميلنا/ نبيل حاج نايف
http://www.alzakera.eu/music/vetenskap/B...o-0136.htm

حتى سلوكيات الحيوانات
http://www.alzakera.eu/music/vetenskap/B...o-0019.htm

فسر لنا التشابه الهائل بين الديناصورات والطيور
http://www.alzakera.eu/music/vetenskap/B...0045-1.htm

فسر لنا اختلاف ألوان البشر ولغاتهم
http://www.alzakera.eu/music/vetenskap/B...o-0074.htm

أخبرنا كيف تحولت الذئاب إلى كلاب
http://www.alzakera.eu/music/vetenskap/B...o-0069.htm

وكيف تحدد الطيور إتجاهات هجرتها .. هذا المقال لطريف سردست
http://www.alzakera.eu/music/vetenskap/B...o-0070.htm

فسر لنا من أين جاءت الأخلاق وتطورها لدى الإنسان والحيوان
http://www.alzakera.eu/music/vetenskap/B...o-0061.htm

فسر لنا المثلية الجنسية عند الحيوان - مقال لطريف أيضا
http://www.alzakera.eu/music/vetenskap/B...o-0097.htm

لماذا تأكل الحيونات أبناءها - لطريف
http://www.alzakera.eu/music/vetenskap/B...o-0130.htm

فهل لدى من يرفضون التطور تفسيرا لكل هذا ؟
------------------------------------------------------------

ثامنا :

لماذا يتم وتم بالسابق استحداث حيوانات مهجنه جديدة هل هى مخلوقة هى الأخرى أم مستحدثه بالتهجين كما حدث فى أنواع الكلاب التى تضاعفت

------------------------------------------------------------

تاسعا :

لماذا هناك تنوع هائل فى الألوان وفى الوان الطيور والأشجار اصحاب نظرية الخلق يقولون لإبهاج الإنسان ومن اجل ( الجمال ) وأنها طلاقة قدرة الخالق وإثبات لوجوده وأصحاب نظرية التطور يقولون انه لا وجود لشىء اسمه الجمال الغير هادف فى التطور وكل لون وكل ثنية وكل نقطه لها وظيفة عملية أساسية ضرورية لبقاء النبات والحيوان ذاته او آخر طفيلى عليه وإذا صدق أصحاب نظرية الخلق فإن الجمال كان يجب ان يكون قليلا قبل خلق الإنسان ولكن الحقيقة غير هذا فالجمال موجود قبل وجود الإنسان بملايين السنين ؟ كما أن الجمال نسبى وبيئى فالزهرة جميلة بالنسبة للشجرة مثلا والكثير من النبات المختلف ينتج بشكل معتاد صنفين من الزهور أحد الصنفين مفتوح وملون ليجتذب الحشرات والآخر مغلق وغير ملون وخال من الرحيق ولا تزوره الحشرات على الإطلاق السبب الوحيد للجمال هو الإنتقاء الجنسى فالذكور تفضل الجمال وكذلك الإناث لذا اختارت الذكر الكثير الألوان وأنتج هو صغارا مشابهة له فى عملية بطيئة طويلة الزمن جدا فاندثرت الذكور ذوى الألوان الباهته وبقيت الجميله

حقائق ظهرت بعد الإنتهاء من الخريطة الجينية للإنسان في 2001 والقرد في 2005
● الشمبانزى أقرب جينيا الى الإنسان أكثر من قربه إلى الغوريلا .. أو إلى أى قرد آخر .
● التطابق الجينى بين الإنسان والشمبانزى يصل إلى أكثر من 96% .
● الجينات الفعالة فى الإنسان تبلغ 30000 جينا جميعها موجودة عند الشمبانزى عدا 53 جينا فقط .
● الأعضاء الأثرية فى الإنسان : الزائدة الدودية -ضروس العقل-أثداء الذكور-عضلات الأذنين والجلد - الفقرات الذيلية -أضلاع الرقبة - شعر الجسم

من منهم آدم ؟ : Ardi- Ida -Lucy -------- الإجابة قد تكون هنا
06-19-2011 12:27 AM
عرض جميع مشاركات هذا العضو إقتباس هذه الرسالة في الرد
إضافة رد 


المواضيع المحتمل أن تكون متشابهة .
الموضوع : الكاتب الردود : المشاهدات : آخر رد
  اسئله عن التطور (متجدد) الوطن العربي 3 1,387 01-18-2013 08:05 PM
آخر رد: الوطن العربي
  إكتشاف آلية التطور من خلية الى تعدد الخلايا طريف سردست 0 1,657 01-20-2012 11:45 AM
آخر رد: طريف سردست
  دور الجينات القافز ة في التطور طريف سردست 12 6,247 09-12-2011 01:40 PM
آخر رد: خالد
Photo سبعة أدلة على حقيقة التطور من كتاب مرآة الكون - الدليل الأول سائل الرب 2 3,919 09-01-2011 07:18 AM
آخر رد: صلاح علي
  عشر مغالطات فيما يخص نظرية التطور Kairos 12 6,273 08-28-2011 09:53 PM
آخر رد: Kairos

التنقل السريع :


مستخدمين يتصفحوا هذا الموضوع: 1 ضيف